) A1 cgcgtcgtattaaaaatcat Forward, 143 nucleotides upstream of stop codon of GH20 (Figure 3.) A2 gatcgataaactggctcgt Reverse, 139 nucleotides upstream of start codon of GH42 (Figure 3.) B1 acgc gtcgac agcagctggatatgctga Forward, SalI site (underlined), 2,316 nucleotides downstream of start codon of GH42 (Figure 3.) B2 ggaa gatctc cggtttccagacttctt Reverse, BglII site (underlined), 159 nucleotides downstream of start codon of hyl Efm (Figure 3.) C1 gttagaagaagtctggaaaccg Forward, 138 nucleotides downstream of start codon of hyl Efm (Figure 3.) C2 tgctaagatattcctctactcg Reverse, 798 nucleotides

upstream of stop codon of hyl Efm (Figure 3.) D1 acat gcatgc agaattggagccttggtt Forward, SphI site (underlined), 169 nucleotides upstream of stop codon of hyl Efm (Figure 3.) D2 cg gaattc tgcttccgcataagaaa Reverse, EcoRI site (underlined), 319 nucleotides upstream of stop codon of down gene (Figure VX-809 order 3.) E1 gcaaggcttcttagaga Forward, ddl E. faecium [32, 33] E2 catcgtgtaagctaacttc Reverse, ddl E. faecium [32, 33] Figure 2 Physical map of the plasmids pHOU1 and pHOU2 for targeted mutagenesis of E. faecium. A, plasmid used for construction of TX1330RF (pHylEfmTX16Δ4genes), TX1330RF(pHylEfmTX16Δ hyl ), TX1330RF(pHylEfmTX16Δ hyl-down ) and TX1330RF (pHylEfmTX16Δ down ) deletion mutants (Figure

1); B, plasmid used for construction of the TX1330RF(pHylEfmTX16Δ7,534) deletion mutant (Figure 1) In order to create a deletion mutant of the hyl Efm -region (which contains genes predicted to be involved Belinostat in vitro in carbohydrate metabolism and transport; Figure 1), fragments upstream (977 bp) and downstream (999 bp) of this region were amplified by PCR (with primers C-D and E-F, respectively;

Table 2) and cloned upstream and downstream of the cat gene in pHOU2, respectively, using BamHI and XhoI for the upstream fragment and ApaI and EcoRI for the downstream fragment; the correct insert was confirmed by sequencing in both directions. This recombinant plasmid was introduced into E. faecalis CK111 by electroporation as described previously [25, 28] and blue colonies were recovered on brain heart infusion (BHI) agar plates containing gentamicin (125 μg/ml) and X-Gal (200 μg/ml). Subsequently, the pHOU2 derivatives were introduced into strain Morin Hydrate TX16 by filter mating [29] with E. faecalis CK111 as the donor. Single cross-over integrants were selected on gentamicin (170 μg/ml) and erythromycin (200 mg/ml) and purified colonies were then resuspended in 50 μl of normal saline and plated on MM9YEG media (salts and yeast extract) supplemented with 7 mM of p -Cl-Phe [25] and incubated for 48 h at 37°C. To confirm that colonies which grew on MM9YEG media supplemented with p -Cl-Phe were excisants, the corresponding colonies were grown simultaneously on BHI agar in the presence and absence of gentamicin.