One SCO colony was plated onto 2% (wt/vol) sucrose-50 μg ml-1 X-Gal to isolate bacteria with a second crossover; this will lead to mutant or wild-type cells depending on the location of the recombination event. In order to screen for impC mutant, DNA was extracted from sucroseS kanS white colonies (obtained from plating M. tuberculosis FAME9 onto sucrose medium) and analysed by PCR using primers that flank the impC gene (TBC1: GGACCGCGATCAGTATGAGT

and TBC2: TCGACACAGAATCCGCTAGA). Strains carrying the impC wild-type allele would produce a band of 1148 bp whereas strains carrying an impC mutation would carry the deletion band of 417 bp. Mutant candidates and a wild-type control were digested with PvuII and subjected to Southern blot analysis using a 2.5 kb impC probe (impC plus flanking region). The wild-type strain showed a 4 kb band whilst PD0332991 in vitro the mutant showed a 3.2 kb deletion band along with a 2.5 kb band for the integrated impC copy Complementation A construct expressing the impC gene was made by PCR amplification of the impC gene, Tariquidar in vivo together with 288 bp of upstream sequence

using chromosomal M. tuberculosis H37Rv as template DNA. The primers tbimpCBamP (CGCGGATCCGGCGATGGTGACAT) and tbimpCBam (CGCGGATCCTTACCCGGCGTTGAGC) were used. The product was digested with BamHI and cloned into the BamHI site of pBluescript-SK+ to produce pFM94. The HindIII cassette of pUC-Gm-int, carrying the int and gm genes was cloned into the HindIII site of pFM94 to produce pFM96. A construct expressing the cysQ gene was made by PCR amplification of the cysQ gene including 352 bp of upstream sequence using M. tuberculosis H37Rv; chromosomal template DNA; primers tbcysup (GCATAGAGCAGGAGGTTTGC) and tbcysend (GCGCCACGCGTCGGCGAT) Isotretinoin were used. The PCR product was treated with T4 polynucleotide kinase and cloned into the SmaI site of pBluescript-SK+ to produce pFM160. The HindIII cassette of pUC-Gm-int, carrying the int and gm genes was cloned into the HindIII site of pFM160 to produce pFM164. Site-directed mutagenesis Site-directed mutagenesis was carried out using the

non-PCR-based Quickchange kit (Stratagene). Oligonucleotides D86N-forward (GGATCGTAGACCCGATCAACGGCACCAAAAACTTTGTGC) & D86N-reverse (GCACAAAGTTTTTGGTGCCGTTGATCGGGTCTACGATCC) were used to prime DNA synthesis with pFM96. Sequencing confirmed the presence of the required mutation. Real-time quantitative PCR RNA was prepared from an exponential (7-day) rolling culture of M. tuberculosis H37Rv [27] and cDNA synthesis was carried out using Superscript II (Invitrogen) according to the manufacturer’s protocol. Primers were designed for Real-time quantitative PCR (RTq-PCR) for sigA (endogenous control), impA suhB, impC and cysQ) using the Primer3 software, ensuring products would be less than 500 bp (Table 2). RTq-PCR reactions were set up using the DyNAmo SYBR Green qPCR kit (MJ Research).