-terminus of the primer. The GC-clamp sequence was CCCCGTGCTCCCCCGCCAATTCCT;. DNA extraction DNA extraction for the rumen epithelium

(0.1 g wet weight) samples was conducted using a QIAamp® DNA Stool Mini Kit (QIAGEN, Hilden, Germany). Prior to extraction, the samples were pretreated find more using the FastPrep®-24 Instrument (MP Biomedicals, South Florida, USA). Then, the procedure followed the kit instructions. DNA extraction for the Milciclib mw culture supernatant (5 ml), the rumen fluid (3 ml), and the solid samples (0.3 g wet weight) were conducted using the cetyltrimethylammonium bromide method [32]. Prior to extraction, all the samples were washed two or three times with PBS buffer.

The DNA extracts were dissolved in 100 μl TE buffer and DNA yield was quantified using a NanoDrop ND-1000 Spectrophotometer (Nyxor Biotech, Paris, France). The DNA extracts were diluted in ddH2O prior to PCR reactions and 1 μl of the diluted DNA solutions (c.10 ~ 20 ng) AZD1480 ic50 were used as templates. PCR-DGGE analysis of methanogen community in subcultures of the co-culture with anaerobic fungi PCR-DGGE analysis of the methanogen community in co-culture with anaerobic fungi was conducted with primers 519f/915GCr (Table 3) according to the methods described in our previous study [12]. The PCR reaction system (50 μl) contained 0.2 μM

of both primers, 240 μM of each dNTP, 1.5 mM of MgCl2 and 2.5 units of Taq DNA polymerase, 1 μl of template DNA. The amplification parameters were as follows: initial oxyclozanide denaturation at 94°C for 4 min, then 35 cycles of 94°C for 30 s, 57°C for 40 s and 72°C for 40 s, and last extension at 72°C for 10 min. DGGE was performed using a Dcode DGGE system (Bio-Rad, Hercules, USA) with 6% (w/v) polyacrylamide gels (acrylamide/N, N’-methylene bisacrylamide ratio, 37: 1 [w/w]) in 0.5 × TAE buffer. The denaturant gradient range of the gel was from 35% to 75%, in which 100% denaturant contained 7 mol · L−1 urea and 40% (v/v) formamide. The electrophoresis was initiated by pre-running for 10 min at 200 V and subsequently ran at 85 V for 16 h at 60°C. The gel was stained with AgNO3 and scanned using GS-800 scanner (Bio-Rad, Hercules, USA). The DGGE profile was analysed by Molecular Analyst 1.61 software (Bio-Rad, Hercules, USA). DGGE bands were excised from the gel and rinsed with ddH2O. The DNA of each band was eluted in sterile TE buffer by incubation for 12 h at 37°C, and served as the template for re-amplification with primers 519f/915r. The PCR products of re-amplification were cloned in Escherichia coli Top10 by using the pGEM-T Easy Vector System (Promega, Madison, WI, USA).