0006) and among patients infected with genotype 2 (92% versus 81%; P = 0.001) but not genotype 3 (90% versus 84%; P = 0.13). In particular, the SVR rates

in patients with a viral load ≤400,000 IU/mL randomized to 24 and 16 weeks of treatment were similar (95% versus 91%; P = 0.20). Assignment to 24 weeks of treatment, absence of advanced fibrosis on liver biopsy, lower HCV RNA level, and lower body weight were significant pretreatment predictors of SVR. The authors concluded the standard 24-week regimen of PEGIFN/ribavirin is significantly more effective than an abbreviated 16-week regimen in genotype 2/3 patients who achieve a rapid virologic response (RVR) (HCV RNA < 50 IU/mL

Staurosporine price at week 4). Abbreviated regimens may be considered in patients with a low baseline viral load who achieve an RVR. The present study, which uses ribavirin 800 mg/day, showed RVR rates of 65.9% (863 of 1309 patients) in patients with HCV-2/3, which was similar to 62% reported by Lagging et al.2 Our previous results from a randomized controlled trial of Taiwanese patients with HCV-2 showed that an RVR was achieved by 86.7% of patients3 which seemed higher than the 64%-75.0% RVR rate for patients with HCV-2 in western countries.4-6 The higher RVR rate in Taiwanese patients may be due to a higher initial selleck screening library dose of ribavirin per body weight (BW) (15.5 mg/kg/day) which makes the possibly “suboptimal” initial doses of ribavirin noteworthy.7 With higher initial dose of ribavirin per BW, the SVR rates in response to short-term

treatment (12-16 weeks) in patients with HCV-2 with RVR were 89%-95% in studies by Dalgard et al., Mangia et al., and Andriulli et al.,4, 5, 8, 9 which were similar to the 92% SVR rate with 24 weeks treatment by Diago et al. In Taiwanese patients with HCV-2 who had RVR, we have shown that the very high SVR rates to 16 weeks and 24 weeks of PEGIFN treatment with weight-based ribavirin at a dose of 1000-1200 mg/day were comparable (100% versus 98%, respectively).3 For SVR, Di Martino et al. reported in their meta-analysis study that 上海皓元医药股份有限公司 shorter-duration therapy with fixed-dose 800 mg/day ribavirin yielded a lower SVR rate than 24 weeks of treatment, and a weight-based ribavirin regimen for a 16-week course of therapy seemed to achieve equivalent effect as a 24-week treatment duration with fixed-dose 800 mg/day ribavirin.10 Diago et al. have reported SVR rates of 92% and 81% in patients with HCV-2 who were treated with PEGIFN and ribavirin 800 mg/day for 24 weeks and 16 weeks, respectively.1 Ferenci et al. have shown the lower rates of SVR in patients with HCV-2 who were treated with lower initiation doses (77.8% and 55.6% with ribavirin 800 mg/day and 400 mg/day for 24 weeks, respectively).

4% for intention-to-treat (ITT) analysis and 87.7% for per-protocol (PP) analysis. The rates were statistically

significantly higher than those in Group Lev (66.2% and 72.6%) (p < 0.05). There were no severe adverse effects found in these two groups. Conclusions:  Fourteen-day quadruple therapy with a combination of proton-pump inhibitor, bismuth citrate, furazolidone, and rufloxacin is considered an effective and safe rescue therapy for H. pylori eradication after failure of standard triple treatment. "
“Background and Aims:  Fluoroquinolone-containing regimens have been suggested as an alternate to standard triple therapy for the treatment of Helicobacter pylori infections. To determine the relationship between fluoroquinolone resistance and mutations of GyrA and GyrB in H. pylori, we PD0325901 order exchanged the mutations at positions 87and 91 of

PARP inhibitor cancer GyrA among fluoroquinolone-resistant clinical isolates. GyrB of a strain with no mutations in GyrA was also analyzed to identify mechanisms of resistance to norfloxacin. Materials & Methods:  Natural transformation was performed using the amplified fragment of the gyrA and gyrB gene as donor DNA. The amino acid sequences of GyrA and GyrB were determined by DNA sequencing of the gyrA and gyrB genes. Results:  Norfloxacin-resistant strains which had mutations at position 87 and 91 became susceptible when the mutations were converted to the wild type. When the mutation from Asp to Asn at position 91 was exchanged to the mutation from Asn to

Lys at position 87, the MIC to levofloxacin, gatifloxacin, and sitafloxacin increased. Norfloxacin-resistant strain TS132 with no mutations in GyrA but had a mutation at position 463 in GyrB. Transformants obtained by natural transformation using gyrB DNA of TS132 had a mutation at position 463 of GyrB and revealed resistant to norfloxacin and levofloxacin. Conclusion:  Mutation from Asn to Lys at position 87 of GyrA confers higher resistance to levofloxacin and gatifloxacin than does mutation medchemexpress from Asp to Asn at position 91. We propose that mutation at position 463 in GyrB as a novel mechanism of fluoroquinolone resistance in H. pylori. “
“Background:  The relationship between H. pylori infection and anemia in childhood is still unclear. The aim of the study was to examine the association between H. pylori infection and anemia or iron deficiency in school-age children and in infants. Materials and Methods:  Six- to 9- year-old Israeli Arab children (N = 202) and infants (N = 197) were examined for hemoglobin and ferritin levels. ELISA was used to detect H. pylori antigens in stool specimens collected from the participants. Household characteristics were obtained through personal interviews with the mothers. Results:  The prevalence of anemia was 15.5 versus 5.5% in H. pylori-positive and -negative school-age children, respectively and 34.5 versus 29.8% in H. pylori-positive and -negative infants, respectively.

001; Fig. 1A). Additionally, in female adjacent tissues, learn more PTPRO was expressed much more highly, compared to male samples (P < 0.01).

PTPRO expression levels in male HCC tissues were negative in 37 cases and weak in 83 cases, according to IHC staining analysis, whereas 18 cases were negative and 42 weak in female HCC tissue samples. We also found greater levels in female adjacent tissues and lower levels in male adjacent tissues (Fig. 1E). Statistical analysis of integrated optical density (IOD) values of 180 slides stained with PTPRO is shown in the histogram (Fig. 1C; P < 0.01). Additionally, our findings indicated that PTPRO expression level was associated with tumor multiplicity and tumor size in the 180 HCC patients (P < 0.01). However, PTPRO expression levels appeared to have only a slight association with age and Edmondson's stage (Supporting Table 1). Taken together, these findings suggest that the decreased expression of PTPRO was associated with the generation or progression of HCC; moreover, our findings suggest that click here PTPRO expression level is potentially mediated by estrogen

regulation. Based on the gender disparity of PTPRO expression and the previous findings in breast cancer, we hypothesized that the decreased PTPRO level in HCC could be the result of ERs. As suggested by our recent report, ERα was distinctly down-regulated in male HCC cases, and this finding correlated with its defensive potential against the development of HCC.39 In this study, we identified the gender difference in ERα expression in 180 pairs of HCC specimens MCE公司 using real-time PCR (Fig. 1B) and IHC analysis (Fig. 1E; P < 0.001). We randomly analyzed correlations between PTPRO and ERα expression in 180 HCC specimens and found that they were positively correlated in adjacent tissues (Fig. 1F; r2 = 0.342, P < 0.001). Additionally,

we investigated ERβ levels, but found no significant differences between HCC and adjacent tissues. Thus, of the two types of ERs, our findings demonstrated that ERα was principally correlated with PTPRO expression in HCC. To confirm the pathological deficiency and gender bias of PTPRO expression, we collected liver specimens from diethylnitrosamine (DEN) treated and healthy mice and detected the expression of ERα and PTPRO by immunochemical staining. Gender disparity of ERα and PTPRO expression was evident in healthy C57BL/6 mice (Fig. 2). Subsequently, in mouse HCC, we found a significant decrease in ERα and PTPRO levels in male mice (P < 0.001), in contrast to the constant expression levels found in female mice that failed in HCC generation. To examine the potential relationship between ERα and PTPRO expression levels, we utilized lentivirus to derive ERα-overexpressing HCC cell lines Huh-7-ERα and SMCC-7721-ERα and determined the fluctuations of PTPRO levels. Expression level of PTPRO was elevated by ERα in the presence of E2 (Fig. 3A). Moreover, we verified by real-time PCR that PTPRO mRNA was up-regulated (Fig. 3B; P < 0.

Fur seals exhibit a high degree of sexual dimorphism resulting in energetic differences among age and sex classes. Therefore, we hypothesized that subadult male and adult female fur seals would differ in the type and size of prey consumed. We examined the diets of subadult male (age 2–8; mean C646 ic50 mass 28–176 kg) and adult female (age ≥ 3 yr; mean mass 13–50 kg) seals on St. Paul Island from 1992 to 2000.

Prey remains found in fecal samples were compared using niche overlap indices. There was nearly complete dietary niche overlap between subadult male and adult female fur seals. Walleye pollock (Theragra chalcogramma), Pacific salmon (Oncorhynchus spp.), Pacific herring (Clupeia pallasi), and cephalopods were common prey items found in the diets of both groups. We found differences in the size of pollock consumed and that geographic location of sample collection may be important in determining diet differences.

Our results indicate high levels of dietary overlap among subadult male and adult female fur seals. “
“Bowhead whales (Balaena mysticetus) of the Bering-Chukchi-Beaufort population migrate in compound screening assay nearshore leads through the Chukchi Sea each spring to summering grounds in the Beaufort Sea. As part of a population abundance study, hydrophones were deployed in the Chukchi Sea off Point Barrow, (12 April to 27 May 2011) and in the Beaufort Sea (12 April to 30 June 2011). Data from these sites were analyzed for the presence of bowhead whale song. We identified 12 unique song types sung by at least 32 individuals during ~95 h of recordings off Point Barrow. Six of these songs were detected at the Beaufort MARU site as well as six additional song types that were not analyzed. These results suggest a shared song repertoire among some individuals. This report represents the greatest number of songs to date during the spring migration for this population. We attribute this greater variety to population growth over the 30 yr since acoustic monitoring began in the early 1980s. Singing during early to mid-spring is consistent with the hypothesis that song is a reproductive display, but further research is necessary to understand

the exact function of this complex vocal behavior. “
“The Australian sea lion (Neophoca cinerea) population medchemexpress at Seal Bay Conservation Park, South Australia, is estimated to be declining at a rate of 1.14% per breeding season. To better understand the potential causes of this decline, survival rates were examined to 14 yr of age for eight cohorts marked as pups (aged 0.17 yr) between 1991 and 2002. Apparent yearly survival rates (Φ) varied by cohort for pups from marking to weaning at 1.5 yr (Φ= 0.30–0.67). Postweaning juvenile survival (1.5–3 yr) was 0.89 and survival from 3 to 14 yr was constant (Φ female:male = 0.96:0.89). Φ of pup cohorts was negatively correlated to local sea surface temperature where the sea lions forage (SST) and was especially low for cohort 7 in 2000 (0.30).

We found that Selleckchem AUY-922 it was not only effective in the treatment of neurasthenia, but also improved and eliminated the symptoms of FD. Since then, we gave flupentixol and melitracen to patients with FD accompanied by vexation, irritability and other emotional abnormalities, with very high efficacy achieved.

Finally, we also gave flupentixol and melitracen to patients with FD not accompanied by insomnia or emotional abnormalities, with effective rate of about 80%. Because of the above experience, we extended the use of flupentixol and melitracen to the treatment of functional diseases, such as gastroesophageal reflux disease (GERD) and functional abdominal pain, and organic diseases, such as peptic

ulcer and jaundice which is mainly manifested in increased indirect bilirubin, also with amazing therapeutic effects. How flupentixol and melitracen works for such dieases has aroused our consideration. From a pharmacological point of view, it is used for the treatment of mild to moderate anxiety and depression, both of which are mostly psychological phenomena, essentially resulting from psychological activity. Therefore, we believe that its BMS-777607 in vitro therapeutic mechanism is to change the psychological activity by regulating the neurotransmitters. Then, there are two explanations for the mechanism of its improvement of digestive symptoms. First, the digestive symptoms are caused by anxiety and depression. This is difficult to understand, because psychiatric symptoms are not the cause and it can not cause other symptoms. Besides, in many FD patients without anxiety or depression, the symptoms were also improved by administration of this drug, indicating that it improves the psychological

activity via neurotransmitters, and thus achieves a clinical effect. Second, like psychiatric symptoms, the digestive symptoms are psychological phenomena in essence. This can explain why the drug can treat patients with FD not accompanied by psychiatric symptoms. In summary, if the majority of the symptoms of FD are psychological phenomena, a 上海皓元医药股份有限公司 new theoretical system, that is, the “general medical psychology” system must be built. Medical psychology is a science that studies psychological activities through psychological phenomena, such as emotion, cognition and behavior, mainly by psychiatrist and psychologists. General medical psychology holds that some clinical symptoms and phenomena in the systems of human body, such as diarrhea, desire to defecate, chest oppression, shortness of breath, high blood pressure and high blood sugar are also psychological phenomena, and they are mainly studied by non-psychiatrist and non-psychologist. Once the “general medical psychology” system is established, “psychological” is no longer synonymous with “mental”.

Statistical analysis indicated that the difference is significant (P<0.01).The animal experiments showed that tumors were formed in abdominal cavity in 70% mice of the FATE/BJ-HCC-2 gene-transfected group, but only in 10% mice of mock control group. Furthermore we also find tumor formation in livers of mice of the FATE/BJ-HCC-2 gene-transfected group with naked eyes and under light microscope. There was no tumor cell growth in liver of the mice of mock control group. Conclusion: FATE/BJ-HCC-2 could induce differential expression of a group of genes in tumor cells. It enhances invasion function of tumor cells. Tumor cells with FATE/BJ-HCC-2 expression are easier to form

tumors and tumor’s metastasis. This suggests that FATE/BJ-HCC-2 may be an important factor to promote metastasis of tumor cells. Disclosures: selleck inhibitor The following

people have nothing to disclose: Xiaoang Yang, Lili Ge, Junyan Piao, Yanhui Yin, Yu Zhang Background: Semaphorin7a (sema7a) is a membrane-anchored protein involved in neuronal and immune function regulating axonal growth, immune and inflammatory response. Recent evidences have confirmed an effect of sema7a on the regulation of bleomycin-induced pulmonary fibrosis. Our group have shown the involvement of sema7a in liver fibrogenesis, but no information are currently available on hepatocarcinogene-sis. Aims: to evaluate whether SEMA7A regulate HCC development. Methods: Liver injury was

induced in vivo by diethylnitrosamine (DEN) i.p. injection (25 mg/Kg) in 15 days old wild type and SEMA7A KO mice. Kupffer cells, hepatic stellate cells (HSCs) and hepatocytes VX-809 cost were isolated with a nyco-denz-based gradient method from mice livers. Recombinant protein for SEMA7A was used for in vitro experiments in primary hepatocytes and human HepG2 cells. Results: In vivo, mice treated with DEN developed HCC formation after 上海皓元 6 month from the treatment. The number of tumor nodules were significantly lower in SEMA7A KO mice than in WT mice, with an average of 8,2 macroscopic nodules in WT and 3,4 in the SEMA7A KO mice. Morevoer the average of the tumour size was 4.5 mm in WT vs 2 mm in SEMA7A KO. In vitro, we observed an increased expression of SEMA7A mRNA in hepatic stellate cells and in Kupffer cells isolated from fibrotic mouse livers, while a low expression was observed in hepatocytes. Hepatocytes do express one of the main receptor of sema7a: plexin C1, demonstrated by RT PCR. Moreover, primary hepatocytes from WT mice and human HepG2 cells, incubated with sema7a recombinant protein (1nM), show an increase in Ki67 mRNA, PCNA protein expression and a modification in the mRNA levels of carcinogenetic markers: 2.1 folds reduction and 4,1 fold increase respectively in PTEN and osteopontin mRNA expression vs untreated cells. Conclusions: SEMA7A is expressed in the liver and plays a crucial role in the development of HCC.

Statistical analysis indicated that the difference is significant (P<0.01).The animal experiments showed that tumors were formed in abdominal cavity in 70% mice of the FATE/BJ-HCC-2 gene-transfected group, but only in 10% mice of mock control group. Furthermore we also find tumor formation in livers of mice of the FATE/BJ-HCC-2 gene-transfected group with naked eyes and under light microscope. There was no tumor cell growth in liver of the mice of mock control group. Conclusion: FATE/BJ-HCC-2 could induce differential expression of a group of genes in tumor cells. It enhances invasion function of tumor cells. Tumor cells with FATE/BJ-HCC-2 expression are easier to form

tumors and tumor’s metastasis. This suggests that FATE/BJ-HCC-2 may be an important factor to promote metastasis of tumor cells. Disclosures: buy GSI-IX The following

people have nothing to disclose: Xiaoang Yang, Lili Ge, Junyan Piao, Yanhui Yin, Yu Zhang Background: Semaphorin7a (sema7a) is a membrane-anchored protein involved in neuronal and immune function regulating axonal growth, immune and inflammatory response. Recent evidences have confirmed an effect of sema7a on the regulation of bleomycin-induced pulmonary fibrosis. Our group have shown the involvement of sema7a in liver fibrogenesis, but no information are currently available on hepatocarcinogene-sis. Aims: to evaluate whether SEMA7A regulate HCC development. Methods: Liver injury was

induced in vivo by diethylnitrosamine (DEN) i.p. injection (25 mg/Kg) in 15 days old wild type and SEMA7A KO mice. Kupffer cells, hepatic stellate cells (HSCs) and hepatocytes selleck inhibitor were isolated with a nyco-denz-based gradient method from mice livers. Recombinant protein for SEMA7A was used for in vitro experiments in primary hepatocytes and human HepG2 cells. Results: In vivo, mice treated with DEN developed HCC formation after 上海皓元医药股份有限公司 6 month from the treatment. The number of tumor nodules were significantly lower in SEMA7A KO mice than in WT mice, with an average of 8,2 macroscopic nodules in WT and 3,4 in the SEMA7A KO mice. Morevoer the average of the tumour size was 4.5 mm in WT vs 2 mm in SEMA7A KO. In vitro, we observed an increased expression of SEMA7A mRNA in hepatic stellate cells and in Kupffer cells isolated from fibrotic mouse livers, while a low expression was observed in hepatocytes. Hepatocytes do express one of the main receptor of sema7a: plexin C1, demonstrated by RT PCR. Moreover, primary hepatocytes from WT mice and human HepG2 cells, incubated with sema7a recombinant protein (1nM), show an increase in Ki67 mRNA, PCNA protein expression and a modification in the mRNA levels of carcinogenetic markers: 2.1 folds reduction and 4,1 fold increase respectively in PTEN and osteopontin mRNA expression vs untreated cells. Conclusions: SEMA7A is expressed in the liver and plays a crucial role in the development of HCC.

We have concluded that the combination of bolus and continuous infusion of rFVIIa is safe and effective, and more convenient to administer than simple bolus infusion therapy to achieve haemostasis at peri-operative periods. In addition, our data also concurs with the data of several previous reports which showed that orthopaedic surgery for haemophilia patients with inhibitors by means selleck products of rFVIIa is

safe and effective. “
“This chapter contains sections titled: von Willebrand factor screening tests von Willebrand factor diagnostic tests von Willebrand factor confirmatory tests von Willebrand disease diagnosis References “
“For several decades, US government agencies have partially supported regional networks of Hemophilia Treatment Centers (HTC). HTC multidisciplinary teams provide comprehensive and coordinated diagnosis, treatment, prevention, education, outreach and surveillance services to improve the health of people with genetic bleeding disorders. However, national data are scarce on HTC-patient population trends and services. The aim of the study was to examine national trends over the past 20 years in patient diagnoses, demographics and health services utilization among the Health Resources and Services Administration (HRSA) and Centers for Disease Control and Prevention (CDC)-supported HTC network.

Diagnoses, demographics and health services utilization data from 1990 to 2010 were aggregated from all HTCs using the Hemophilia Data Set (HDS). From 1990 to 2010, Cobimetinib solubility dmso the HTC population grew 90% from 17 177 to 32 612. HTC patients with von Willebrand’s disease increased 上海皓元 by 148%, females

by 346%, Hispanic patients by 236% and African Americans by 104%. Four thousand and seventy-five deaths were reported. From 2002 to 2010, annual comprehensive evaluations grew 38%, and persons with severe haemophilia on a home intravenous therapy programme rose 37%. In 2010, 46% of patients were less than 18 years vs. 24% for the general US population. The Hemophilia Data Set documents the growth and diversity of the US Hemophilia Treatment Center Network’s patient population and services. Despite disproportionate deaths due to HIV, the HTC patient base grew faster than the general US population. The HDS is a vital national public health registry for this rare-disorder population. Over the past 20 years, US residents with genetic chronic bleeding disorders have obtained an array of health services from the national network of regionally organized Hemophilia Treatment Centers (HTC) [1, 2]. All Hemophilia Treatment Centers (HTC) in the US, in collaboration with the Health Resources and Services Administration (HRSA) and the Centers for Disease Control and Prevention (CDC), annually collect and report aggregate data to assess population and service characteristics. However, national examinations of longitudinal trends of the US HTC-patient population and services utilized are scarce.

The densities of immunoblot bands were analyzed using ImageJ computer software (NIH). Two methods were used. An Amaxa Nucleofector (Lonza Group, Ltd., Switzerland) was used according to the instructions to produce transient transfections of human embryonic kidney cells (HEK293 cells; American Type Culture Collection, Manassas, VA). Five micrograms of DNA were used per 1 × 106 cells in 100 μL of Nucleofector solution. Adriamycin clinical trial Program Q-001

was used for the HEK293 cells. The stable cell line was produced using FuGENE reagent (Roche). Cells were plated on six-well plates and transfected with 1 μg DNA (pcDNA3 with appropriate insert) using 4 μL of FuGENE reagent in 2 mL of Dulbecco’s modified Eagle medium (DMEM) + 10% fetal bovine serum (FBS). After 48 hours, G418 was added to select the stable clones. The expression of each GPCR was confirmed by immunofluorescence staining followed by confocal microscopy. For GFP-S1P1 and GFP-S1P2, cells were inspected for GFP fluorescence and sorted by flow cytometry. The stable clones of each GPCR and vector only were maintained in culture medium containing G418 (100 μg/mL). The lentiviral selleck vectors containing the stem loop sequences of shRNA specifically targeting the rat S1P2 and scrambled control sequence were a gift from

Murthy Karnam (Department of Physiology and Biophysics, Virginia Commonwealth University, Richmond, VA). The 上海皓元医药股份有限公司 silencing efficiency of each shRNA was confirmed by western blot analysis in HEK293 cell–transfected myc-tagged rat S1P2 using myc antibody as reported.29 The sequences for control shRNA and S1P2-shRNA used in this study were as follows: control shRNA: TCCTAAGGTTAAGTCGCCCTCG; S1P2-shRNA: AGGAACAGCAAG TTCTACTCA. The recombinant lentiviruses were produced

by transient transfection of HEK293FT cells (Invitrogen) using FuGENE (Roche). Briefly, HEK293FT cells were cultured in high-glucose DMEM, supplemented with 10% FBS, penicillin/streptomycin (100 U/mL), 0.1 mM nonessential amino acids, and 500 μg/mL of G418. The subconfluent cells in a 10-cm culture dish were cotransfected with lentiviral vector (5 μg), the lentiviral packaging vectors pRSV-REV (1.25 μg) and pMDLg/pRRE (2.5 μg), and the vesicular stomatitis virus G glycoprotein (VSVG) expression vector pMD2G (1.5 μg). The viruses were collected from the culture supernatants on day 3 after transfection, passed through a 22-gauge needle, and centrifuged at 350 g for 7 minutes. The supernatants were then centrifuged at 80,000 g for 90 minutes at 4°C, and the pellet was resuspended in 50 μL PBS. Titers were determined by infecting HEK293FT cells in a 24-well plate with serial dilutions of concentrated lentivirus, and counting enhanced (E)GFP-expressing cells after 48 hours under fluorescent microscopy (transfecting units per mL = number of cells × dilution × 100).

genego.com) and Ingenuity Pathway Analysis (IPA; Ingenuity Systems; www.ingenuity.com). Consensus findings

from these tools were used to interpret and understand the biological mechanisms behind the data. Microarray data have been deposited to the NCBI’s Gene Expression Omnibus repository (accession no.: GSE38872). Mice were fasted for 4 hours and were intraperitoneally (IP) injected Nivolumab with 10 µCi of [1-14C]-sodium acetate (PerkinElmer, Waltham, MA). Mice were sacrificed 30 minutes after injection, and ∼250 mg of liver were rinsed in ice-cold 1× phosphate-buffered saline. Liver tissue was saponified in a 2.2-mL mixture of 50% KOH/95% ethanol (1:10, v/v) at 70°C overnight. 3H-cholesterol (1 µCi) was added to the same tube as a recovery control. Sterols were extracted in 3 mL of hexane, dried, and redissolved VX-770 in a 300-μL mixture of acetone/ethanol (1:1, v/v). Sterols were then precipitated with 1 mL of digitonin (0.5% in 95% ethanol) overnight at room temperature. Saponified fatty acids were acidified and extracted with petroleum ether. WT and Cyp7a1-tg mice were IP injected with a single dose of glucose (8 g/kg) containing 5 µCi of [1-14C] glucose (PerkinElmer) as an isotope tracer. Mice were allowed free access to standard chow and water, and feces were collected for 3 consecutive days. Fecal samples were then homogenized in a 5-mL mixture of 50% KOH/95% ethanol (1:10, v/v) at 70°C overnight.

3H-cholesterol (1 µCi) was added to the same tube as a recovery control. Neutral sterols were separated from bile acids by extraction in 6 mL of hexane, dried, and redissolved in a 1-mL mixture of acetone/ethanol (1:1, v/v) and were then precipitated with 3 mL of digitonin (0.5% in 95% ethanol) overnight at room temperature. Adenovirus-expressing miR-33a was purchased from Applied Biological Materials, Inc. (Richmond, British Columbia, Canada). Adeno-null, which does not express a gene product,

was purchased from Vector Biolabs (Philadelphia, PA). Adenovirus was administered 上海皓元 at 2 × 109 pfu/mouse through the tail vein. Experiments were carried out 7 days postinjection. Results were expressed as mean ± standard error (SE), unless noted. Statistical analysis was performed by the Student t test; P < 0.05 indicates statistical significance. To obtain molecular insight into the role of bile acid synthesis in maintaining hepatic lipid homeostasis, we used microarray gene profiling to identify differentially expressed genes in livers of chow-fed and Western high-fat-diet (HFD)-fed Cyp7a1-tg and WT mice. Under chow-fed conditions, 77 genes were identified as differentially expressed with a 2-fold induction or a 50% inhibition, whereas under WD-fed conditions, 144 genes were differentially expressed (Supporting Fig 1A). There were 52 differentially expressed genes that were identified by comparison under both chow-fed and WD-fed conditions.