coli and Salmonella[15, 16]. In addition, C. jejuni also lacks the oxidative stress response regulatory elements SoxRS and OxyR, and osmotic shock

protectants such as BetAB [13, 17]. However, C. jejuni does contain the global ferric uptake regulator Belnacasan in vivo (Fur) that regulates genes in response to iron transport, metabolism, and oxidative stress defence [18–20] and is involved in acid stress in Salmonella and Helicobacter pylori[21, 22]. Compared with many other foodborne pathogens, C. jejuni is more sensitive to acid exposure [23]. This sensitivity is probably not only due to the lack of an acid resistance system but also to the lack of the mentioned regulatory proteins. How then does C. jejuni respond on the proteomic level when exposed to low pH? Recently, a transcriptomic analysis of C. jejuni NCTC 11168 found changes in the expression of hundreds of genes upon acid shock or in a simulated gastric environment. Primarily, genes involved in encoding ribosomal proteins, transcription and translation, and amino acid biosynthesis were down-regulated [24]. Many of the genes up-regulated by acid Tanespimycin stress in that study have previously been characterized

as heat shock and oxidative stress genes [24]. However, microarray data are complex and all the up-regulated genes do not necessarily translate into changes in specific proteins vital for survival [25, 26]. Here, we want to analyze the acid stress response of C. jejuni strains with different acid sensitivity. Since weak isothipendyl and strong acids have different modes of action on the bacterial cell [15, 27], the acid induced response to both a weak acid, acetic acid, which can be encountered in foods) and a strong acid (HCl, which is found in the gastric fluid) was analyzed and compared. Proteins synthesized during stress were labelled

by incorporation of radioactive methionine and separated by two-dimensional (2D) electrophoresis. At first, a chemically defined broth (CDB) suitable for growth of different C. jejuni strains therefore had to be developed with minimal concentrations of methionine in order to minimize competition with radioactive methionine added upon stress exposure. Methods Bacterial strains and preparation of inocula Three sequenced C. jejuni strains were tested for acid stress response: the clinical human isolate C. jejuni NCTC 11168 from the National Collection of Type Cultures, strain 305 (GeneBank accession number ADHL00000000 [28]) and strain 327 (GeneBank accession number ADHM00000000 [29]). Strains 305 and 327 were originally isolated from turkey production by Prof. Thomas Alter, Freie Universität, Berlin. Previous results (Birk et al. 2010, data not shown [23]) have found that strain 305 was less sensitive towards tartaric acid, and strain 327 was more sensitive to tartaric acid than the NCTC 11168, respectively. Strain 305 was denoted as acid-tolerant and strain 327 as acid-sensitive.

Detection of adenoviruses in cells SW480 and LoVo cells as well as intestinal epithelial cells (IEC) were plated at 105 cells per 6 cm dish and infected with ZD55-Sur-EGFP or AD-Sur-EGFP for 48 h and 72 h. The expression of enhanced green fluorescent protein (EGFP) was accessed by a Zeiss fluorescence microscope coupled with a digital camera photo apparatus. RT-PCR analysis Total RNA from transfected cells was isolated using TRIzol (Invitrogen) as recommended

by the manufacturer. RT-PCR was used for the analysis of Survivin mRNA with GAPDH as an internal Panobinostat control. Primers for Survivin were as follow: forward primer 5′-GAC CAC CGC ATC TCT ACA TTC-3′, reverse primer 5′-GTT CTT GGC TCT TTC TCT GTCC-3′. The GAPDH primers were forward 5′-ACC ACA GTC CAT GCC ATC AC-3′ and reverse 5′-TCC ACC ACC CTG TTG CTG TA-3′. Reactions were performed in accordance with the standard protocol. PCR was performed Selleckchem Kinase Inhibitor Library by initial denaturation at 94°C for

5 min followed by 35 cycles of 30 s at 94°C, 30 s at 58°C and 60 s at 72°C. The products were separated by electrophoresis in 2% agarose and visualized with ethidium bromide. Experiments were performed in triplicate. Western blot analysis Cells were transfected with adenoviruses and incubated for 48 h. After that they were harvested and the protein extracts were separated via sodium dodecyl sulfate-polyacdene gel electrophoresis and transferred onto nitrocellulose membranes. The membranes were then blocked with rabbit anti-Survivin, Ad2 E1A, β-actin (Santa Cruz), XIAP (Sigma) and caspase-3 (Beyotime, China) primary polyclonal antibodies respectively at 4°C overnight. After washing with PBS 3-oxoacyl-(acyl-carrier-protein) reductase containing 0.05% Tween 20 the membranes

were incubated with secondary antibody (goat anti-rabbit, Santa Cruz) for 2 h. They were visualized by chemiluminescence system according to manufacturer’s instruction. In vitro cytopathic assay Cells were grown subconfluently and infected with adenoviruses with indicated MOIs. 5 days later, the medium was removed and the cells were washed with PBS twice, exposed to Coomassie brilliant blue and then washed with distilled water. The result was documented as photographs. MTT cell viability assay To quantify the cytopathic effect, MTT assay was performed. Cells were seeded in 96-well plates for 24 h at 1 × 104 per well. After 1 to 5 days of various viruses infection, 15 μl MTT (5 mg/ml in PBS) was added to each well for 4 h incubation at 37°C followed by the addition of 150 μl DMSO. Absorbance at 570 nm was measured for cell viability in each well. Flow cytometry evaluation Apoptosis of cells infected with adenoviruses at MOI of 5 was determined by flow cytometry (FCM) using Annexin V: PE Apoptosis Detection Kit I (BD Biosciences, USA) according to manufacturer’s instruction. Briefly, Cells were washed twice with cold PBS and resuspended in binding buffer at a concentration of 1 × 105 cells/ml.

Steady-state conditions were reached after 2–3 days. Setipiprant concentrations did not accumulate following 5.5 days of bid administration (Sidharta et al., unpublished data). In a phase IIa proof-of-mechanism study in patients with mild to moderate allergic asthma, setipiprant (1,000 mg bid) significantly improved the forced expiratory volume in 1 second (FEV1) after a bronchial allergen challenge when compared with placebo during selleck compound the late allergic reaction (3–10 h) [5]. Another phase IIa study showed significant efficacy versus placebo in

seasonal allergic rhinitis [6]. Additional phase II studies with setipiprant in asthma and seasonal allergic rhinitis did not confirm efficacy and therefore the company decided to focus

clinical development on the more potent follow-up compound [7]. In this article, we present the results from the absorption, distribution, metabolism, and excretion (ADME) study in healthy male subjects following 5-Fluoracil cost administration of a single oral dose of 1,000 mg of 14C-labeled setipiprant. 2 Materials and Methods 2.1 Reference Compounds and Other Materials Setipiprant (ACT-129968, 2-(2-(1-naphthoyl)-8-fluoro-3,4-dihydro-1H-pyrido[4,3-b]indol-5(2H)-yl)acetic acid) was synthesized at Almac Pharma Services, Craigavon, UK. The 14C-label of [14C]setipiprant was located at the carbonyl of the naphthoyl group and the labeled compound was also synthesized by Almac Pharma Services (Fig. 4). [14C]setipiprant was mixed in a ratio of approximately 1:2,200 with nonlabeled setipiprant and filled in hard gelatin capsules of 250 mg for oral administration.

Tangeritin [14C]stearic acid for quality control purposes was obtained from ARC-Inc., St. Louis, MO, USA. 2.2 Subjects and Dosing The clinical part of this study was conducted at Covance (Allschwil, Switzerland), formerly called Swiss Pharma Contract. All subjects gave written informed consent. The study was conducted in accordance with good clinical practice (GCP) and the Declaration of Helsinki. Six healthy male Caucasian subjects, with a mean age of 59.3 years (range 51–65) and a mean body mass index (BMI) of 24.4 kg/m2 (range 21.1–27.8), participated in this study. Subjects remained fasted for 10 h before, and for up to 4 h after, study drug administration. All subjects received a single dose of 1,000 mg setipiprant administered as four capsules of 250 mg with a total radioactivity of 2.60–2.62 MBq (approximately 71 μCi). 2.3 Safety and Tolerability Safety and tolerability were evaluated by monitoring of adverse events, clinical laboratory tests, 12-lead electrocardiograph (ECG) recordings, and measuring of supine vital signs. 2.

The plates were incubated at 37°C overnight and the clear zone at the agar/Petri dish interface was measured as per Harunur-Rashid and Kornberg [30] followed by staining with coomassie brilliant blue G250 (0.5% (w/v) in 25% (v/v) isopropanol/10% (v/v)

acetic acid) for 30 Selumetinib price min to increase contrast. All motility assays were performed in triplicate. Detection of pilA and fliC genes was confirmed as described by Kus et al. [31] with modifications in the primers as shown in Table 1. PilA genes of isolates 1, 40 and 48 were amplified with the primer set pilB2 and tRNAThr, and for isolate 72, the primer set pilA and tRNAThr. FilC genes of isolates 1 and 72 were amplified with primers fliCFor3 and fliCRev2 [32], and for isolates 40, 41 and 48 the primer set fliCFor2 and fliCRev2. The resultant amplicons were ligated into a pT7Blue-2 cloning vector and transformed into NovaBlue Singles using a Perfectly Blunt Cloning Kit (Novagen). Plasmid DNA was extracted from broth cultures using a Rapid Plasmid Miniprep Kit (Qiagen) and the inserts sequenced. Primers SeqU19, SeqT7 and pre-pilA were used in the sequencing of all cloned KPT330 pilA genes. In addition, clones from isolates 1, 40 and 48 required use of primer pilB2 while isolate 72 required the primer pilA. Primers SeqT7 and SeqU19 were used to sequence the cloned fliC genes from all four isolates.

The sequences for isolates 1, 40, 41 and 48 have been deposited in GenBank. For the fliC gene the accession numbers are EF418192, EF418193, EF418194, and EF418195 respectively while for the pilA gene EF418188, EF418189, EF418190 and EF418191, respectively). Gfp tagging of P. aeruginosa isolates was carried out by mobilising the pBK-miniTn7-gfp3 and pUX-BF13 plasmids (Table 2) as per Koch et al. [13]. Insertion was confirmed by PCR using transrev/transfor primers (Table 1) giving a 150 bp amplicon.

Table 2 Strains and plasmids used in this study. Strain/plasmids Genotype/phenotype Source/reference E. coli E coli JM109 End1 recA1 gyrA96 this hsdR17(rk -mk +) relA1 supE44 Δlac-proAB (F’ traD36 proAB DNA ligase lacIqZΔAM15) Promega P. aeruginosa ATCC 15442   Centre for Biofilm Engineering, Montana Plasmids     pRK2013 ColE1-Tra(RK2)+Kmr Figurski & Helinski, (1979) [47] pUX-BF13 R6 K replicon -based helper plasmid providing the Tn7 transposition function in trans. Apr, mob+ Bao et al. (1991) [48] pBK-miniTn7-gfp3 pUC19 based delivery plasmid or miniTn7-gfp3. Kmr, Apr, Cmr, Smr, mob+ Koch et al. (2001) Microtitre plate assay for assessment of biofilm formation P. aeruginosa strains were grown to an attenuance (D600 nm) of 0.5 and diluted 100-fold with LB broth following which 100 μl aliquots were dispensed into triplicate microtitre plates which were incubated at 37°C.

) A1 cgcgtcgtattaaaaatcat Forward, 143 nucleotides upstream of stop codon of GH20 (Figure 3.) A2 gatcgataaactggctcgt Reverse, 139 nucleotides upstream of start codon of GH42 (Figure 3.) B1 acgc gtcgac agcagctggatatgctga Forward, SalI site (underlined), 2,316 nucleotides downstream of start codon of GH42 (Figure 3.) B2 ggaa gatctc cggtttccagacttctt Reverse, BglII site (underlined), 159 nucleotides downstream of start codon of hyl Efm (Figure 3.) C1 gttagaagaagtctggaaaccg Forward, 138 nucleotides downstream of start codon of hyl Efm (Figure 3.) C2 tgctaagatattcctctactcg Reverse, 798 nucleotides

upstream of stop codon of hyl Efm (Figure 3.) D1 acat gcatgc agaattggagccttggtt Forward, SphI site (underlined), 169 nucleotides upstream of stop codon of hyl Efm (Figure 3.) D2 cg gaattc tgcttccgcataagaaa Reverse, EcoRI site (underlined), 319 nucleotides upstream of stop codon of down gene (Figure VX-809 order 3.) E1 gcaaggcttcttagaga Forward, ddl E. faecium [32, 33] E2 catcgtgtaagctaacttc Reverse, ddl E. faecium [32, 33] Figure 2 Physical map of the plasmids pHOU1 and pHOU2 for targeted mutagenesis of E. faecium. A, plasmid used for construction of TX1330RF (pHylEfmTX16Δ4genes), TX1330RF(pHylEfmTX16Δ hyl ), TX1330RF(pHylEfmTX16Δ hyl-down ) and TX1330RF (pHylEfmTX16Δ down ) deletion mutants (Figure

1); B, plasmid used for construction of the TX1330RF(pHylEfmTX16Δ7,534) deletion mutant (Figure 1) In order to create a deletion mutant of the hyl Efm -region (which contains genes predicted to be involved Belinostat in vitro in carbohydrate metabolism and transport; Figure 1), fragments upstream (977 bp) and downstream (999 bp) of this region were amplified by PCR (with primers C-D and E-F, respectively;

Table 2) and cloned upstream and downstream of the cat gene in pHOU2, respectively, using BamHI and XhoI for the upstream fragment and ApaI and EcoRI for the downstream fragment; the correct insert was confirmed by sequencing in both directions. This recombinant plasmid was introduced into E. faecalis CK111 by electroporation as described previously [25, 28] and blue colonies were recovered on brain heart infusion (BHI) agar plates containing gentamicin (125 μg/ml) and X-Gal (200 μg/ml). Subsequently, the pHOU2 derivatives were introduced into strain Morin Hydrate TX16 by filter mating [29] with E. faecalis CK111 as the donor. Single cross-over integrants were selected on gentamicin (170 μg/ml) and erythromycin (200 mg/ml) and purified colonies were then resuspended in 50 μl of normal saline and plated on MM9YEG media (salts and yeast extract) supplemented with 7 mM of p -Cl-Phe [25] and incubated for 48 h at 37°C. To confirm that colonies which grew on MM9YEG media supplemented with p -Cl-Phe were excisants, the corresponding colonies were grown simultaneously on BHI agar in the presence and absence of gentamicin.

sphaeroides protein in each duplicate protein-pair,

HIF inhibitor review the tree type (Type-A or Type-B) for the protein-pair, and the bootstrap values for each tree. Of the total 234 protein-pairs, ~77% of the protein-pairs (180 pairs) exhibited a Type-A relationship and ~23% of the protein-pairs (54 pairs) showed a Type-B relationship. Figure 6 The phylogenetic relationship of duplicate protein pairs and their highest matching ortholog sequences. Maximum likelihood trees representing four of these relationships are shown above for hisD I and hisD II , sdhB and frdB, sac1 and a hypothetical protein, and traI and a hypothetical protein. Each of these unrooted trees displayed a bootstrap value of 100. The offshoots represent branches and their lengths are given (trees are not to scale). The relationships depict two types of topology – Type A or Type B. The strength of the tree topology was analyzed using bootstrap

values, information concerning which is also shown in Additional file 2. Bootstrap values for 8 trees could not be determined due to the lack of one or more orthologs. C646 ic50 Bootstrap values not only signify the significance of a tree topology (Type-A and Type-B), but also provide an insight into the relative origin of a given gene duplication. Gene duplication events that occurred significantly before organism speciation would display Type-A relationships with high bootstrap values. Gene duplication events that occurred significantly after organism speciation would display Type-B relationships with similarly high bootstrap values. Of the 226 trees for which bootstrap values were obtained, 209 (92.5%) Methocarbamol had bootstrap values ≥ 95. The bootstrap values remained significant within both Type-A and Type-B phylogenetic trees.

Of the 180 Type-A trees, 172 (95.56%) exhibited ≥ 95 bootstrap values while of the 46 Type-B trees, 37 (80.43%) exhibited ≥ 95 bootstrap values. Thus, the majority of these trees demonstrated correct and significant trees topologies, which support the relative timings of the origins of these gene duplications. These results clearly show that a majority of gene duplications in R. sphaeroides originated prior to the formation of the R. sphaeroides lineage as also shown in Table 1. Of the Type-A gene duplications, 58.33% (105 pairs) were found only on CI, 26.67% (48 pairs) were found between CI and CII, and 6.11% (11 pairs) were found only on CII. Since about 91% of the duplications exhibiting a Type-A relationship were distributed on the two chromosomes, these results submit that the origin of multiple chromosomes in R. sphaeroides predates the origin of this species. 13 proteins had indiscernible matches to any orthologs in the current microbial database. Moreover, although a vast majority of the genes (312 of 360 genes, 86.

HCV is a member of the Flaviviridae family. Its 9.6-kb RNA genome carries a long open reading frame. This frame is co- and post-translationally cleaved by cellular and viral proteases [23] into structural

proteins (core, E1, and E2) and nonstructural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B). Core, E1, and E2, the structural proteins, constitute the major viral components of the viral particles, while the nonstructural proteins are required at multiple levels of the virus life cycle, including viral RNA replication [24] and infectious-particle assembly [25]. The single open reading frame is located between two untranslated regions (UTRs), the 5’ UTR and the 3’ UTR, which contain RNA sequences essential for RNA translation and replication, respectively [26–28]. Falcon et al. observed the presence of https://www.selleckchem.com/products/ly2157299.html enveloped VLPs with an average diameter of

65 nm in the cytoplasm and inside cytoplasmic vesicles in HCV-infected patient liver tissue. Smaller enveloped VLPs with diameters ranging from 30 to 55 nm were also localized in the cytoplasm of hepatocytes. All of these VLPs were clearly composed of an inner electron-dense core-like particle surrounded by an envelope. In addition, large numbers of unenveloped selleck VLPs resembling nucleocapsid-like structures of 30 nm in diameter were detected mainly in the cytoplasm and also in the ER membranes [29]. Similarly, Chua et al. constructed HCV virus-like particles using a recombinant adenovirus

containing encoding the GABA Receptor HCV structural proteins (core, E1, and E2) of HCV 77H, genotype 1a [30]. The baculovirus/insect cell system has been used extensively for the production of VLPs to study viral assembly processes in the absence of infectious viruses, produce antigens for immunization and proteins for diagnostic assays and for gene transfer [31–34]. In this study, various fusion proteins of HCV core, peptides RGD (Arg-Gly-Asp), and IFN-α2a fragments (His-H1, His-H2, His-H3, and His-H4) were successfully expressed via the baculovirus expression system and purified by Ni-NTA agarose. Transcriptional and translational analysis results show that transcriptional levels and expression levels of vAcH1 and vAcH2 are higher than the vAcH3 and vAcH4. His-H1, His-H2, His-H3, and His-H4 all can specifically bind with MDA-MB231. The binding activity of His-H1 and His-H2 is stronger than His-H3 and His-H4 (Figure 1E). The binding activity of His-H1 and His-H2 on MDA-MB231 increased with protein concentration (from 0.5 to 10 μM). At the same time, HCV core, peptide RGD, and IFN-α2a fragments were expressed by baculovirus expression system and assembled into VLPs.

83 + 0.79 kg, PL 1.10 + 0.88

kg), potentially linked to the increased caloric load. Conclusion Although there was a limited sample size for each supplement group, preliminary data suggests that Venetoclax mw consuming Cr+RT is as effective as consuming Cr+CHO in regards to gains in LBM and strength over the course of 8 weeks of resistance training. Acknowledgements Supported by Athletic Edge Nutrition. References 1. Jäger R, Kendrick IP, Purpura M, Harris RC, Ribnicky DM, Pischel I: The effect of Russian Tarragon (artemisia dracunculus L.) on the plasma creatine concentration with creatine monohydrate administration. J Int Soc Sports Nutr 2008,5(Suppl 1):P4.CrossRefPubMedCentral 2. Oliver JM, Jagim AR, Sanchez A, Kelley K, Galvan E, Fluckey J, Riechman S, Greenwood M, Jäger R, Purpura M, Pischel I, Kreider

RB: Effects of short-term ingestion of Russian Tarragon prior to creatine monohydrate supplementation see more on whole body and muscle creatine retention: a preliminary investigation. J Int Soc Sports Nutr 2012,9(Suppl 1):P24.CrossRefPubMedCentral”
“Background Green tea, caffeine, conjugated linoleic acid (CLA), and branched chain amino acids (BCAA) have shown to individually improve body composition and metabolic rate in overweight and obese individuals. The purpose of this study was to investigate the effects of a multi-ingredient dietary supplement (MIDS) containing these ingredients on body composition, lipid profile, and metabolic rate in overweight and obese individuals. Methods Forty-nine healthy, sedentary, overweight or obese men and women were stratified by

body fat percentage and randomly assigned to two groups: 1) a soybean oil placebo (PL) or 2) a MIDS containing 500 mg of green tea extract (45% EGCG), Farnesyltransferase 99 mg of caffeine, and a proprietary blend containing 1260 mg of CLA, L-leucine, L-isoleucine and L-valine per serving. Twenty-nine participants completed the study (Mean ± SD; PL: n=16; age, 27.7 + 10.6 yrs; body mass, 88.7 + 3.7 kg; BMI, 31.5 ± 4.6; body fat% 42.3 + 7.2; MIDS n=13; age, 31.8 + 11.3 yrs; body mass, 95.5 + 4.1 kg; BMI, 33.5 + 4.2; body fat% 44.5 + 6.1) with 14 participants withdrawing due to personal reasons or time constraints and 6 people excluded due to low compliance (<80%). Both groups consumed one serving with breakfast and one serving with lunch for 8 weeks with no other changes to nutrition or exercise habits. Laboratory testing took place at baseline and after the 8-week intervention. Body composition was analyzed with dual-energy x-ray absorptiometry. Resting metabolic rate (RMR), lipid profile, waist and hip circumferences were measured while subjects were fasting. Data were analyzed using JMP 09 Pro (Cary, NC), with alpha level at 0.05. A one-way ANOVA was used to evaluate baseline differences and a two-way ANOVA with repeated measurements was used to evaluate changes in dependent variables over time.

Transformants carrying either of the two fusion constructs produced levan similar to the PG4180.M6 mutant complemented with lscB. Western blotting, zymographic detection, and qRT-PCR analyses confirmed these results but also allowed a more detailed view; native lscB and the lscB UpN A fusion had similar mRNA expression levels while that of the fusion lscB Up A, which lacked the 48-bp of N-terminal LscB-coding region, had less. Consequently, one might speculate that although

the -450 bp upstream DNA region of lscB, which includes the TSS as determined Rucaparib clinical trial in this study, is sufficient for expression of lscA, the first 48-bp of the lscB ORF increase the level of its expression. Since our respective results of Western blotting and zymographic detection of Lsc activity were indistinguishable from each other, it could be concluded that the N-terminus of LscB might not be involved in altering check details of enzymatic activities. A peculiar observation was the electrophoretic migration of the individual proteins or fusion proteins in polyacrylamide gels. The observed faster migration of LscBUpNA as compared to LscB under denaturing conditions could potentially be attributed to the apparent mass shift for two proteins with nearly identical

molecular masses as described earlier [26]. Interestingly, the migration of LscBUpNA was significantly slower than that of LscB under native conditions. This finding might demonstrate that modest changes in the protein’s surface charge might result in significant find more alterations of electrophoretic mobility [22, 27, 28]. Although the different migration rates of the proteins or fusion proteins under native or denaturing conditions suggested that the synthesized

proteins were indeed different from each other, a MALDI-TOF analysis of each of the proteins was conducted using protein samples from zymograms. The produced levan surrounding the proteins did not seem to impact mass spectrometric analysis. The MASCOT score for each of the identified proteins was above the significance threshold of 100. The sample from the PG4180.M6(lscB) sample gave LscB from P. syringae pv. phaseolicola 1448A as the first significant match which was in line with the high homology of the respective genes in the close relatives pv. glycinea and pv. phaseolicola [24]. The sample from PG4180.M6(lscBUpA) which should synthesize only LscA gave the first significant match as LscA from P. syringae pv. glycinea race 4 strain. This proved that the lscB Up A fusion actually synthesized an active LscA and confirmed earlier findings that artificial expression of LscA of PG4180 leads to levan formation [10]. Although the majority of obtained peptides for the sample representing LscBUpNA were LscA-borne as expected, the unique N-terminal 2,122-Da peptide NSPLASMSNINYAPTIWSR could be detected.

2007, 253:4156–4160.CrossRef 22. To WK, Tsang CH, Li HH, Huang Z: Fabrication of n-type mesoporous silicon nanowires by one-step etching. Nano letters 2011, 11:5252–5258.CrossRef 23. Hochbaum AI, Gargas D, Hwang YJ, Yang P: Single crystalline mesoporous silicon nanowires. Nano letters

2009, 9:3550–3554.CrossRef 24. Zhong X, Qu Y, Lin YC, Liao L, Duan X: Unveiling the formation pathway of single crystalline porous silicon nanowires. ACS Appl mater Inter 2011, 3:261–270.CrossRef 25. Zhang ML, Peng KQ, Fan X, Jie JS, Zhang RQ, Lee ST, Wong NB: Preparation of large-area uniform silicon nanowires arrays through metal-assisted chemical etching. J Phys Chem C 2008, 112:4444–4450.CrossRef 26. Balasundaram K, Sadhu click here JS, Shin

JC, Bruno A, Chanda D, Malik M, Hsu K, Rogers JA, Ferreira P, Sinha S, Li X: Porosity control in metal-assisted chemical etching of degenerately doped silicon nanowires. Nanotechnology 2012, 23:305304.CrossRef 27. Lin L, Guo S, Sun X, Feng J, Wang Y: Synthesis and photoluminescence properties of porous silicon nanowire arrays. Nanoscale Res Lett 1822–1828, 2010:5. 28. Smith ZR, Smith RL, Collins SD: Mechanism selleck chemicals llc of nanowire formation in metal assisted chemical etching. Electrochim Acta 2013, 92:139–147.CrossRef 29. Magoariec H, Danescu A: Modeling macroscopic elasticity of porous silicon. Phys Status Solidi C 2009, 6:1680–1684.CrossRef 30. Huang Z, Shimizu T, Senz S, Zhang Z, Geyer N, Gösele U: Oxidation rate effect on the direction of metal-assisted chemical and electrochemical etching of silicon. J Phys Chem C 2010, 114:10683–10690.CrossRef 31. Huang Z, Shimizu Megestrol Acetate T, Senz S, Zhang Z, Zhang X, Lee W, Geyer N, Gösele U: Ordered arrays of vertically aligned [110] silicon nanowires by suppressing the crystallographically preferred < 100 > etching directions. Nano letters 2009, 9:2519–2525.CrossRef 32. Oskam

G, Long JG, Natarajan A, Searson PC: Electrochemical deposition of metals onto silicon. J Phys D Appl Phys 1998, 31:1927–1949.CrossRef 33. Cullis AG, Canham LT, Calcott PDJ: The structural and luminescence properties of porous silicon. J Appl Phys 1997, 82:909–965.CrossRef 34. Chartier C, Bastide S, Lévy-Clément C: Metal-assisted chemical etching of silicon in HF–H 2 O 2 . Electrochim Acta 2008, 53:5509–5516.CrossRef 35. Kooij ES, Butter K, Kelly JJ: Silicon etching in HNO 3 /HF solution: charge balance for the oxidation reaction. Electrochem Solid-State lett 1999, 2:178–180.CrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions SL designed the experiment, analyzed results, and drafted the manuscript. WM and YZ offered financial support. XC and YX offered technical supports. MM, WZ, and FW participated in revising the manuscript. All authors read and approved the final manuscript.